tfrc cd71 Search Results


94
Miltenyi Biotec fc 1 20
Fc 1 20, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/CD71+Antibody%2C+anti-human/pmc08184214-16-12-6
Average 94 stars, based on 1 article reviews
fc 1 20 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

95
Sino Biological c terminus
(A) Protein diagram. VP1u-APEX2 consists of APEX2 fused to <t>the</t> <t>C-terminus</t> of the unique region of B19V VP1 (VP1u) via a seven-residue glycine-serine linker (GGSGGSG), followed by a Flag tag and a 6 × Histidine (His) tag. APEX2 has a linker-Flag-His tag fused at the C-terminus. (B) Analysis of purified proteins. VP1u-APEX2 and APEX2 proteins were expressed in bacteria and purified. Approximately (∼) 1 µg of each protein was separated by SDS-PAGE, followed by Coomassie blue staining. M, molecular weight marker. (C) Confocal microscopy of VP1u-APEX2 entry. 1 × 10 6 UT7/Epo-S1 cells were incubated with 2 μM VP1u-APEX2 or APEX2 protein at 37°C for 2 h. The cells were then immunostained with α-Flag to visualize internalized proteins under a Leica STED confocal microscope. Scale bar = 10 μm. Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole). (D) Western blotting of APEX2-biotinylated proteins. 1 × 10 7 UT7/Epo-S1 cells were incubated with 2 μM VP1u-APEX2 or APEX2 protein at 37°C. After 2 h, APEX2-mediated biotinylation was then performed as described in the Materials and Methods and Figure S1 . Biotinylated host proteins were purified with streptavidin-conjugated magnetic beads. The supernatant was collected as the flow-through (FT), and the beads were further washed several times and eluted as the pull-down (PD). Both FT and PD samples were analyzed by SDS-PAGE and immunoblotting using Alexa Fluor 680-conjugated streptavidin. (E) Analysis of VP1u-APEX2-biotinylated/associated proteins using quantitative mass spectrometry (qMS). Three independent PD samples prepared from VP1u-APEX2 and APEX2 (control) treated cells were analyzed by on-bead digestion and qMS. MS data were processed and analyzed as described in the Materials and Methods. The bubble plot shows protein enrichment (log 2 fold change) in the VP1u-APEX2 group relative to the APEX control, with color indicating subcellular localization based on Gene Ontology (GO) annotation. TFRC denotes human transferrin receptor 1 (hTfR).
C Terminus, supplied by Sino Biological, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/Human+Transferrin+Receptor+%2F+TFRC+%2F+CD71+Protein/bio_rxiv__64898__2026__04__02__715920-221-12-25
Average 95 stars, based on 1 article reviews
c terminus - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

93
OriGene murine transferrin receptor
a , Schematic representation of a single-crypt DNAm analysis coupled with RNA sequencing. b , Scatter-plot showing the average DNAm level on the Dkk1 , Dkk2 , Sfrp1 and Sfrp2 gene promoters in single crypts isolated from aged mice. The most methylated crypts (the top 10%, high 5mC crypts) and the least-methylated crypts (the bottom 10%, low 5mC crypts) were selected and analyzed by RNA-seq. n = 4 mice were used. c , PCA of single crypt RNA-seq datasets generated in crypts of the top 10% (high 5mC crypts, red dots) and the bottom 10% (low 5mC crypts, blue dots) as in b . To assess the statistical significance of the separation between two groups, a MANOVA test using Pillai’s trace was performed, yielding a highly significant result ( P = 4.235 × 10 −5 ). d , <t>Transferrin</t> receptor ( Tfrc ) and ferroportin ( Slc40a1 ) expression levels in high ( n = 16) and low ( n = 12) 5mC crypts as in b . P value was calculated by a two-tailed Welch’s t -test. Each dot represents a single crypt. n = 4 mice were used. e , Western blot analysis of the protein levels of TfR1 and ferroportin (FPN1) in small intestinal crypts isolated from young and aged mice. Actin was used as a loading control. n = 5 mice per group were analyzed. f , Ferrous (Fe 2+ ) iron levels in small intestinal crypts isolated from young and aged mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. g , Schematic representation of our hypothesis. h , Quantification of TET hydroxymethylase enzymatic activity in intestinal crypts isolated from young ( n = 5) and aged ( n = 6) mice. P value was calculated by a two-tailed Welch’s t -test. i , Quantification of DNMT enzymatic activity in the intestinal crypts isolated from young ( n = 4) and aged ( n = 5) mice. P value was calculated by a two-tailed Welch’s t -test. j , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing at the indicated time points upon C35 TET inhibitor treatment of organoids derived from young intestinal crypts. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -tests. k , Bar charts showing DNAm level of the Dkk1 and Dkk2 gene promoters in intestinal crypts isolated from wild-type (WT) and Tet2/3 -dKO mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. l , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing in organoids treated with the iron chelator, DFO for 1 and 2 months. n = 3 mice per group were analyzed. P value was calculated by a two-tailed paired t -test. Error bars in the figure bar charts represent the s.d.
Murine Transferrin Receptor, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/Tfrc+(NM_011638)+Mouse+Untagged+Clone/pmc12705458-291-4-13
Average 93 stars, based on 1 article reviews
murine transferrin receptor - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Miltenyi Biotec cd71 apc
a , Schematic representation of a single-crypt DNAm analysis coupled with RNA sequencing. b , Scatter-plot showing the average DNAm level on the Dkk1 , Dkk2 , Sfrp1 and Sfrp2 gene promoters in single crypts isolated from aged mice. The most methylated crypts (the top 10%, high 5mC crypts) and the least-methylated crypts (the bottom 10%, low 5mC crypts) were selected and analyzed by RNA-seq. n = 4 mice were used. c , PCA of single crypt RNA-seq datasets generated in crypts of the top 10% (high 5mC crypts, red dots) and the bottom 10% (low 5mC crypts, blue dots) as in b . To assess the statistical significance of the separation between two groups, a MANOVA test using Pillai’s trace was performed, yielding a highly significant result ( P = 4.235 × 10 −5 ). d , <t>Transferrin</t> receptor ( Tfrc ) and ferroportin ( Slc40a1 ) expression levels in high ( n = 16) and low ( n = 12) 5mC crypts as in b . P value was calculated by a two-tailed Welch’s t -test. Each dot represents a single crypt. n = 4 mice were used. e , Western blot analysis of the protein levels of TfR1 and ferroportin (FPN1) in small intestinal crypts isolated from young and aged mice. Actin was used as a loading control. n = 5 mice per group were analyzed. f , Ferrous (Fe 2+ ) iron levels in small intestinal crypts isolated from young and aged mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. g , Schematic representation of our hypothesis. h , Quantification of TET hydroxymethylase enzymatic activity in intestinal crypts isolated from young ( n = 5) and aged ( n = 6) mice. P value was calculated by a two-tailed Welch’s t -test. i , Quantification of DNMT enzymatic activity in the intestinal crypts isolated from young ( n = 4) and aged ( n = 5) mice. P value was calculated by a two-tailed Welch’s t -test. j , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing at the indicated time points upon C35 TET inhibitor treatment of organoids derived from young intestinal crypts. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -tests. k , Bar charts showing DNAm level of the Dkk1 and Dkk2 gene promoters in intestinal crypts isolated from wild-type (WT) and Tet2/3 -dKO mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. l , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing in organoids treated with the iron chelator, DFO for 1 and 2 months. n = 3 mice per group were analyzed. P value was calculated by a two-tailed paired t -test. Error bars in the figure bar charts represent the s.d.
Cd71 Apc, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/CD71+Antibody%2C+anti-human%2C+REAfinity/pmc12320723-60-19-21
Average 93 stars, based on 1 article reviews
cd71 apc - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Proteintech tfr1
a , Schematic representation of a single-crypt DNAm analysis coupled with RNA sequencing. b , Scatter-plot showing the average DNAm level on the Dkk1 , Dkk2 , Sfrp1 and Sfrp2 gene promoters in single crypts isolated from aged mice. The most methylated crypts (the top 10%, high 5mC crypts) and the least-methylated crypts (the bottom 10%, low 5mC crypts) were selected and analyzed by RNA-seq. n = 4 mice were used. c , PCA of single crypt RNA-seq datasets generated in crypts of the top 10% (high 5mC crypts, red dots) and the bottom 10% (low 5mC crypts, blue dots) as in b . To assess the statistical significance of the separation between two groups, a MANOVA test using Pillai’s trace was performed, yielding a highly significant result ( P = 4.235 × 10 −5 ). d , <t>Transferrin</t> receptor ( Tfrc ) and ferroportin ( Slc40a1 ) expression levels in high ( n = 16) and low ( n = 12) 5mC crypts as in b . P value was calculated by a two-tailed Welch’s t -test. Each dot represents a single crypt. n = 4 mice were used. e , Western blot analysis of the protein levels of TfR1 and ferroportin (FPN1) in small intestinal crypts isolated from young and aged mice. Actin was used as a loading control. n = 5 mice per group were analyzed. f , Ferrous (Fe 2+ ) iron levels in small intestinal crypts isolated from young and aged mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. g , Schematic representation of our hypothesis. h , Quantification of TET hydroxymethylase enzymatic activity in intestinal crypts isolated from young ( n = 5) and aged ( n = 6) mice. P value was calculated by a two-tailed Welch’s t -test. i , Quantification of DNMT enzymatic activity in the intestinal crypts isolated from young ( n = 4) and aged ( n = 5) mice. P value was calculated by a two-tailed Welch’s t -test. j , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing at the indicated time points upon C35 TET inhibitor treatment of organoids derived from young intestinal crypts. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -tests. k , Bar charts showing DNAm level of the Dkk1 and Dkk2 gene promoters in intestinal crypts isolated from wild-type (WT) and Tet2/3 -dKO mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. l , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing in organoids treated with the iron chelator, DFO for 1 and 2 months. n = 3 mice per group were analyzed. P value was calculated by a two-tailed paired t -test. Error bars in the figure bar charts represent the s.d.
Tfr1, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/CD71+Antibody/pm41407700-311-10-11
Average 96 stars, based on 1 article reviews
tfr1 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
OriGene tfrc
a , Schematic representation of a single-crypt DNAm analysis coupled with RNA sequencing. b , Scatter-plot showing the average DNAm level on the Dkk1 , Dkk2 , Sfrp1 and Sfrp2 gene promoters in single crypts isolated from aged mice. The most methylated crypts (the top 10%, high 5mC crypts) and the least-methylated crypts (the bottom 10%, low 5mC crypts) were selected and analyzed by RNA-seq. n = 4 mice were used. c , PCA of single crypt RNA-seq datasets generated in crypts of the top 10% (high 5mC crypts, red dots) and the bottom 10% (low 5mC crypts, blue dots) as in b . To assess the statistical significance of the separation between two groups, a MANOVA test using Pillai’s trace was performed, yielding a highly significant result ( P = 4.235 × 10 −5 ). d , <t>Transferrin</t> receptor ( Tfrc ) and ferroportin ( Slc40a1 ) expression levels in high ( n = 16) and low ( n = 12) 5mC crypts as in b . P value was calculated by a two-tailed Welch’s t -test. Each dot represents a single crypt. n = 4 mice were used. e , Western blot analysis of the protein levels of TfR1 and ferroportin (FPN1) in small intestinal crypts isolated from young and aged mice. Actin was used as a loading control. n = 5 mice per group were analyzed. f , Ferrous (Fe 2+ ) iron levels in small intestinal crypts isolated from young and aged mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. g , Schematic representation of our hypothesis. h , Quantification of TET hydroxymethylase enzymatic activity in intestinal crypts isolated from young ( n = 5) and aged ( n = 6) mice. P value was calculated by a two-tailed Welch’s t -test. i , Quantification of DNMT enzymatic activity in the intestinal crypts isolated from young ( n = 4) and aged ( n = 5) mice. P value was calculated by a two-tailed Welch’s t -test. j , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing at the indicated time points upon C35 TET inhibitor treatment of organoids derived from young intestinal crypts. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -tests. k , Bar charts showing DNAm level of the Dkk1 and Dkk2 gene promoters in intestinal crypts isolated from wild-type (WT) and Tet2/3 -dKO mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. l , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing in organoids treated with the iron chelator, DFO for 1 and 2 months. n = 3 mice per group were analyzed. P value was calculated by a two-tailed paired t -test. Error bars in the figure bar charts represent the s.d.
Tfrc, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/CD71+(TFRC)+(NM_003234)+Human+Recombinant+Protein/us10048266-177-16-26
Average 90 stars, based on 1 article reviews
tfrc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene expression constructs for tfr1
Protein sequencing results.
Expression Constructs For Tfr1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/CD71+(TFRC)+(NM_003234)+Human+Tagged+ORF+Clone/pmc05089552-43-0-23
Average 90 stars, based on 1 article reviews
expression constructs for tfr1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene human lztfl1
(A) Schematic representation of potential protein-binding domains of <t>LZTFL1.</t> (B) Purified LZTFL1 fused with maltose-binding protein (MBP, left ) as well as individual subunits of AP-1 complex (β1, γ, μ1, and σ1) fused with glutathione S-transferase (GST, right ) were visualized by Coomassie Brilliant Blue (CBB) staining. Full-length GST-β1 and GST-γ are indicated with red asterisks. (C) Purified MBP or MBP-LZTFL1 was incubated with each of the purified GST-fused subunits of the AP-1 complex (β1, γ, μ1, and σ1), and the LZTFL1-bound subunit was purified by amylose resin and analyzed by western blotting using anti-MBP and anti-GST antibodies. The GST-β1 band is indicated with a red asterisk. (D, top) Purified wild-type LZTFL1 and LZTFL1 mutants fused with MBP and (D, bottom) β1 and β2 subunits of AP-1 and AP-2 respectively fused with GST were visualized by CBB staining. Purified MBP, MBP-LZTFL1, or mutants were incubated with (E) GST-β1 (AP-1) or (F) GST-β2 (AP-2) and pulled-down proteins were analyzed by western blotting using anti-MBP and anti-GST antibodies. (G) Brain tissue lysate from wild-type and Lztfl1 -knockout mice was analyzed by western blotting using anti-LZTFL1 antibody, anti-γ subunit of AP-1 antibody, anti-α subunit of AP-2 antibody, and REVERT staining for total protein (left) . Lysate was immunoprecipitated with anti-LZTFL1-conjugated beads. The LZTFL1-interacting proteins were eluted by NuPAGE LDS buffer and analyzed by western blotting using anti-LZTFL1, anti-γ subunit of AP-1, and anti-α subunit of AP-2 antibodies (right) . (H, left) Lysate from HEK293FT cells transiently expressing FLAG or LZTFL1-FLAG was analyzed by western blotting using anti-FLAG, anti-β1 subunit and anti-γ subunit of AP-1, and anti-β-actin antibodies or (I, left) anti-FLAG, anti-α subunit of AP-2, and anti-actin antibodies. (H, right) Cell lysate was immunoprecipitated with anti-FLAG M2 magnetic beads. The LZTFL1-interacting proteins were eluted by 3X FLAG peptide and analyzed by western blotting using anti-FLAG, anti-β1 subunit of AP-1, and anti-γ subunit of AP-1 antibodies or (I, right) anti-FLAG and anti-α subunit of AP-2 antibodies.
Human Lztfl1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/CD71+(TFRC)+Mouse+Monoclonal+Antibody/pmc06939906-26-2-17
Average 90 stars, based on 1 article reviews
human lztfl1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
OriGene 7157 rev 5 tggatggtggtacagtcagagc 3 tfrc
(A) Schematic representation of potential protein-binding domains of <t>LZTFL1.</t> (B) Purified LZTFL1 fused with maltose-binding protein (MBP, left ) as well as individual subunits of AP-1 complex (β1, γ, μ1, and σ1) fused with glutathione S-transferase (GST, right ) were visualized by Coomassie Brilliant Blue (CBB) staining. Full-length GST-β1 and GST-γ are indicated with red asterisks. (C) Purified MBP or MBP-LZTFL1 was incubated with each of the purified GST-fused subunits of the AP-1 complex (β1, γ, μ1, and σ1), and the LZTFL1-bound subunit was purified by amylose resin and analyzed by western blotting using anti-MBP and anti-GST antibodies. The GST-β1 band is indicated with a red asterisk. (D, top) Purified wild-type LZTFL1 and LZTFL1 mutants fused with MBP and (D, bottom) β1 and β2 subunits of AP-1 and AP-2 respectively fused with GST were visualized by CBB staining. Purified MBP, MBP-LZTFL1, or mutants were incubated with (E) GST-β1 (AP-1) or (F) GST-β2 (AP-2) and pulled-down proteins were analyzed by western blotting using anti-MBP and anti-GST antibodies. (G) Brain tissue lysate from wild-type and Lztfl1 -knockout mice was analyzed by western blotting using anti-LZTFL1 antibody, anti-γ subunit of AP-1 antibody, anti-α subunit of AP-2 antibody, and REVERT staining for total protein (left) . Lysate was immunoprecipitated with anti-LZTFL1-conjugated beads. The LZTFL1-interacting proteins were eluted by NuPAGE LDS buffer and analyzed by western blotting using anti-LZTFL1, anti-γ subunit of AP-1, and anti-α subunit of AP-2 antibodies (right) . (H, left) Lysate from HEK293FT cells transiently expressing FLAG or LZTFL1-FLAG was analyzed by western blotting using anti-FLAG, anti-β1 subunit and anti-γ subunit of AP-1, and anti-β-actin antibodies or (I, left) anti-FLAG, anti-α subunit of AP-2, and anti-actin antibodies. (H, right) Cell lysate was immunoprecipitated with anti-FLAG M2 magnetic beads. The LZTFL1-interacting proteins were eluted by 3X FLAG peptide and analyzed by western blotting using anti-FLAG, anti-β1 subunit of AP-1, and anti-γ subunit of AP-1 antibodies or (I, right) anti-FLAG and anti-α subunit of AP-2 antibodies.
7157 Rev 5 Tggatggtggtacagtcagagc 3 Tfrc, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/CD71+(TFRC)+(NM_001128148)+Human+Untagged+Clone/pmc12196323__oncotarget-16-28750-s001-52-75-74
Average 93 stars, based on 1 article reviews
7157 rev 5 tggatggtggtacagtcagagc 3 tfrc - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
OriGene anti cd71 antibody
Fig. 3. Distribution of certain glycoproteins on the cellular lipid raft during PRRSV entry and lipid raft-location of receptor CD163. (A) The distribution of Gp3, Gp4, Gp5, and CD163 in the different sucrose gradient fractions during entry. PAMs were incubated with Hpv at an MOI of 5 at 4 1C for 1 h and then switched to 37 1C for 2 h. Cells were extracted in Triton X-100 and fractionated by discontinuous sucrose gradient centrifugation as described in Materials and Methods. The fractions were separated by SDS-12% PAGE and transferred to PVDF membranes for immunoblot analysis for nonraft marker <t>CD71,</t> raft maker caveolin (Cav), Gp3, Gp4, Gp5, or CD163. (B) The distribution of Gp3, Gp4, Gp5, and CD163 in different sucrose gradient fractions during PRRSV entry upon MβCD pretreatment. PAMs were pretreated with 20 mM MβCD for 1 h and then incubated with Hpv at an MOI of 5 at 4 1C for 1 h and then switched to 37 1C for 2 h. Cells were extracted in Triton X-100 and fractionated by discontinuous sucrose gradient centrifugation as described in Materials and Methods. The fractions were separated by SDS-12% PAGE and transferred to PVDF membranes for immunoblot analysis for CD71, Cav, Gp3, Gp4, Gp5, or CD163. (C) MβCD treatment affected the distribution of CD163. Hela cells were transfected with plasmid encoding CD163 and treated with 20 mM MβCD at 37 1C for 1 h at 24 h post transfection. The cells treated with PBS were set as a control. The expression of CD163 on cell membrane was stained by indirect immunofluorescence assay after MβCD treatment. (D) Association of CD163 with lipid rafts. PAMs were extracted in Triton X-100 and fractionated on sucrose gradients. Proteins were resolved on SDS-PAGE and transferred to PVDF membrane for immunoblot analysis of CD163, Cav, and CD71.
Anti Cd71 Antibody, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/CD71+(TFRC)+Mouse+Monoclonal+Antibody/pm26115164-197-0-5
Average 90 stars, based on 1 article reviews
anti cd71 antibody - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

94
ProSci Incorporated rab11a
HEV pORF1 predominantly localizes to CD63-positive vesicular structures. Analyses of subcellular distribution of pORF1 ectopically expressed in A549/D3 cells. ( A ) Confocal microscopy of double-tagged pORF1; EGFP-mCherry Merge displays the subcellular distribution of EGFP ( green )-mCherry ( red ) fusion protein without insertion of pORF1. C-term, C-terminal mCherry; N-term, N-terminal EGFP. ( B ) Particle analysis of only C-terminus–containing vesicles (C-term) and N- and C-terminus-containing vesicles (C+N-terminus). ∗∗∗ P > .0001; ∼300 particles were analyzed. ( C ) Confocal microscopy of C-terminally mScarlet-tagged pORF1 ( red ) and indirect immunofluorescent stain of different organelle marker proteins ( green ); ERGIC53, ERGIC; GM130, Golgi; EEA1, EEs; <t>Rab11a,</t> REs; LC3B, APs; LAMP2, LYs; CD63, MVBs. ( D ) Particle analysis of pORF1-containing vesicles (pORF1 alone) and pORF1- and marker protein–containing vesicles (pORF1 + marker); between ∼200 and ∼1000 particles were analyzed for each organelle marker. Single channels depicted as greyscale images with headers indicating the channel coloring; zoom refers to areas magnified from white rectangles in merge; white ellipses indicate nucleus; scale bar represents 40 μm. APs, autophagosomes; EEs, early endosomes; ERGIC, ER-Golgi intermediate compartment; Golgi, Golgi apparatus; LYs, lysosomes; MVBs, multivesicular bodies; REs, recycling endosomes. Data are displayed as mean ± standard error of the mean. Microscopy performed on Leica TCS SP8 System with 100× objective (numerical arperture 1.4). Images deconvoluted via lightning algorithm using LAS X Control software.
Rab11a, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/Transferrin+Receptor+(Extracellular+domain)+Antibody/pmc10900777-277-26-30
Average 94 stars, based on 1 article reviews
rab11a - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

91
Boster Bio transferrin receptor 1 tfr1
SIRT1/NRF2/GPX4 pathway is involved in hippocampal ferroptosis in aged mice. (A) WB images and quantification analysis of SIRT1, NRF2 and GPX4 in the hippocampus of aged mice. (B) WB images and quantification analysis of SLC7A11, <t>TFR1,</t> IRP2 and ferritin in the hippocampus of aged mice ( n = 3 per group). (C) qRT‐PCR expression of SIRT1, NRF2, GPX4, SLC7A11, TFR1, IRP2 and ferritin mRNA in the hippocampus of aged mice ( n = 3 per group). Values are presented as mean ± SEM. ** p < 0.01 compared with the C group; # p < 0.05 and ## p < 0.01 compared with the M group; + p < 0.05 and ++ p < 0.01 and compared with the EX group.
Transferrin Receptor 1 Tfr1, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tfrc+cd71/Human+TFRC+Recombinant+Protein/pmc12796855-112-27-33
Average 91 stars, based on 1 article reviews
transferrin receptor 1 tfr1 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

Image Search Results


(A) Protein diagram. VP1u-APEX2 consists of APEX2 fused to the C-terminus of the unique region of B19V VP1 (VP1u) via a seven-residue glycine-serine linker (GGSGGSG), followed by a Flag tag and a 6 × Histidine (His) tag. APEX2 has a linker-Flag-His tag fused at the C-terminus. (B) Analysis of purified proteins. VP1u-APEX2 and APEX2 proteins were expressed in bacteria and purified. Approximately (∼) 1 µg of each protein was separated by SDS-PAGE, followed by Coomassie blue staining. M, molecular weight marker. (C) Confocal microscopy of VP1u-APEX2 entry. 1 × 10 6 UT7/Epo-S1 cells were incubated with 2 μM VP1u-APEX2 or APEX2 protein at 37°C for 2 h. The cells were then immunostained with α-Flag to visualize internalized proteins under a Leica STED confocal microscope. Scale bar = 10 μm. Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole). (D) Western blotting of APEX2-biotinylated proteins. 1 × 10 7 UT7/Epo-S1 cells were incubated with 2 μM VP1u-APEX2 or APEX2 protein at 37°C. After 2 h, APEX2-mediated biotinylation was then performed as described in the Materials and Methods and Figure S1 . Biotinylated host proteins were purified with streptavidin-conjugated magnetic beads. The supernatant was collected as the flow-through (FT), and the beads were further washed several times and eluted as the pull-down (PD). Both FT and PD samples were analyzed by SDS-PAGE and immunoblotting using Alexa Fluor 680-conjugated streptavidin. (E) Analysis of VP1u-APEX2-biotinylated/associated proteins using quantitative mass spectrometry (qMS). Three independent PD samples prepared from VP1u-APEX2 and APEX2 (control) treated cells were analyzed by on-bead digestion and qMS. MS data were processed and analyzed as described in the Materials and Methods. The bubble plot shows protein enrichment (log 2 fold change) in the VP1u-APEX2 group relative to the APEX control, with color indicating subcellular localization based on Gene Ontology (GO) annotation. TFRC denotes human transferrin receptor 1 (hTfR).

Journal: bioRxiv

Article Title: Identification of Human Transferrin Receptor as an Entry Co-receptor for Parvovirus B19 Infection of Human Erythroid Progenitor Cells

doi: 10.64898/2026.04.02.715920

Figure Lengend Snippet: (A) Protein diagram. VP1u-APEX2 consists of APEX2 fused to the C-terminus of the unique region of B19V VP1 (VP1u) via a seven-residue glycine-serine linker (GGSGGSG), followed by a Flag tag and a 6 × Histidine (His) tag. APEX2 has a linker-Flag-His tag fused at the C-terminus. (B) Analysis of purified proteins. VP1u-APEX2 and APEX2 proteins were expressed in bacteria and purified. Approximately (∼) 1 µg of each protein was separated by SDS-PAGE, followed by Coomassie blue staining. M, molecular weight marker. (C) Confocal microscopy of VP1u-APEX2 entry. 1 × 10 6 UT7/Epo-S1 cells were incubated with 2 μM VP1u-APEX2 or APEX2 protein at 37°C for 2 h. The cells were then immunostained with α-Flag to visualize internalized proteins under a Leica STED confocal microscope. Scale bar = 10 μm. Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole). (D) Western blotting of APEX2-biotinylated proteins. 1 × 10 7 UT7/Epo-S1 cells were incubated with 2 μM VP1u-APEX2 or APEX2 protein at 37°C. After 2 h, APEX2-mediated biotinylation was then performed as described in the Materials and Methods and Figure S1 . Biotinylated host proteins were purified with streptavidin-conjugated magnetic beads. The supernatant was collected as the flow-through (FT), and the beads were further washed several times and eluted as the pull-down (PD). Both FT and PD samples were analyzed by SDS-PAGE and immunoblotting using Alexa Fluor 680-conjugated streptavidin. (E) Analysis of VP1u-APEX2-biotinylated/associated proteins using quantitative mass spectrometry (qMS). Three independent PD samples prepared from VP1u-APEX2 and APEX2 (control) treated cells were analyzed by on-bead digestion and qMS. MS data were processed and analyzed as described in the Materials and Methods. The bubble plot shows protein enrichment (log 2 fold change) in the VP1u-APEX2 group relative to the APEX control, with color indicating subcellular localization based on Gene Ontology (GO) annotation. TFRC denotes human transferrin receptor 1 (hTfR).

Article Snippet: Purified proteins: Recombinant hTfR ECD protein tagged with a His-tag at the C-terminus (#11020-H07H) and recombinant human ferritin heavy chain 1/FTH1 (#13217-HNAE) were purchased from SinoBiological (Paoli, PA).

Techniques: Residue, FLAG-tag, Purification, Bacteria, SDS Page, Staining, Molecular Weight, Marker, Confocal Microscopy, Incubation, Microscopy, Western Blot, Magnetic Beads, Mass Spectrometry, Control, Protein Enrichment

a , Schematic representation of a single-crypt DNAm analysis coupled with RNA sequencing. b , Scatter-plot showing the average DNAm level on the Dkk1 , Dkk2 , Sfrp1 and Sfrp2 gene promoters in single crypts isolated from aged mice. The most methylated crypts (the top 10%, high 5mC crypts) and the least-methylated crypts (the bottom 10%, low 5mC crypts) were selected and analyzed by RNA-seq. n = 4 mice were used. c , PCA of single crypt RNA-seq datasets generated in crypts of the top 10% (high 5mC crypts, red dots) and the bottom 10% (low 5mC crypts, blue dots) as in b . To assess the statistical significance of the separation between two groups, a MANOVA test using Pillai’s trace was performed, yielding a highly significant result ( P = 4.235 × 10 −5 ). d , Transferrin receptor ( Tfrc ) and ferroportin ( Slc40a1 ) expression levels in high ( n = 16) and low ( n = 12) 5mC crypts as in b . P value was calculated by a two-tailed Welch’s t -test. Each dot represents a single crypt. n = 4 mice were used. e , Western blot analysis of the protein levels of TfR1 and ferroportin (FPN1) in small intestinal crypts isolated from young and aged mice. Actin was used as a loading control. n = 5 mice per group were analyzed. f , Ferrous (Fe 2+ ) iron levels in small intestinal crypts isolated from young and aged mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. g , Schematic representation of our hypothesis. h , Quantification of TET hydroxymethylase enzymatic activity in intestinal crypts isolated from young ( n = 5) and aged ( n = 6) mice. P value was calculated by a two-tailed Welch’s t -test. i , Quantification of DNMT enzymatic activity in the intestinal crypts isolated from young ( n = 4) and aged ( n = 5) mice. P value was calculated by a two-tailed Welch’s t -test. j , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing at the indicated time points upon C35 TET inhibitor treatment of organoids derived from young intestinal crypts. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -tests. k , Bar charts showing DNAm level of the Dkk1 and Dkk2 gene promoters in intestinal crypts isolated from wild-type (WT) and Tet2/3 -dKO mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. l , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing in organoids treated with the iron chelator, DFO for 1 and 2 months. n = 3 mice per group were analyzed. P value was calculated by a two-tailed paired t -test. Error bars in the figure bar charts represent the s.d.

Journal: Nature Aging

Article Title: Iron homeostasis and cell clonality drive cancer-associated intestinal DNA methylation drift in aging

doi: 10.1038/s43587-025-01021-x

Figure Lengend Snippet: a , Schematic representation of a single-crypt DNAm analysis coupled with RNA sequencing. b , Scatter-plot showing the average DNAm level on the Dkk1 , Dkk2 , Sfrp1 and Sfrp2 gene promoters in single crypts isolated from aged mice. The most methylated crypts (the top 10%, high 5mC crypts) and the least-methylated crypts (the bottom 10%, low 5mC crypts) were selected and analyzed by RNA-seq. n = 4 mice were used. c , PCA of single crypt RNA-seq datasets generated in crypts of the top 10% (high 5mC crypts, red dots) and the bottom 10% (low 5mC crypts, blue dots) as in b . To assess the statistical significance of the separation between two groups, a MANOVA test using Pillai’s trace was performed, yielding a highly significant result ( P = 4.235 × 10 −5 ). d , Transferrin receptor ( Tfrc ) and ferroportin ( Slc40a1 ) expression levels in high ( n = 16) and low ( n = 12) 5mC crypts as in b . P value was calculated by a two-tailed Welch’s t -test. Each dot represents a single crypt. n = 4 mice were used. e , Western blot analysis of the protein levels of TfR1 and ferroportin (FPN1) in small intestinal crypts isolated from young and aged mice. Actin was used as a loading control. n = 5 mice per group were analyzed. f , Ferrous (Fe 2+ ) iron levels in small intestinal crypts isolated from young and aged mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. g , Schematic representation of our hypothesis. h , Quantification of TET hydroxymethylase enzymatic activity in intestinal crypts isolated from young ( n = 5) and aged ( n = 6) mice. P value was calculated by a two-tailed Welch’s t -test. i , Quantification of DNMT enzymatic activity in the intestinal crypts isolated from young ( n = 4) and aged ( n = 5) mice. P value was calculated by a two-tailed Welch’s t -test. j , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing at the indicated time points upon C35 TET inhibitor treatment of organoids derived from young intestinal crypts. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -tests. k , Bar charts showing DNAm level of the Dkk1 and Dkk2 gene promoters in intestinal crypts isolated from wild-type (WT) and Tet2/3 -dKO mice. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. l , Bar chart showing DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing in organoids treated with the iron chelator, DFO for 1 and 2 months. n = 3 mice per group were analyzed. P value was calculated by a two-tailed paired t -test. Error bars in the figure bar charts represent the s.d.

Article Snippet: The complementary DNA of murine transferrin receptor ( Tfrc ) was purchased from Origene (plasmid MC221416 ) and cloned into the CSII-EF Venus-P2A-3F-MCS vector using the BamHI and NotI restriction sites.

Techniques: RNA Sequencing, Isolation, Methylation, Generated, Expressing, Two Tailed Test, Western Blot, Control, Activity Assay, Derivative Assay

a , The expression level of the Dnmt enzymes in high (red dots; n = 16) and low (blue dots; n = 12) 5mC crypts based on RNAseq as in Fig. . b , The expression level of the Tet enzymes in high (red dots; n = 16) and low (blue dots; n = 12) 5mC crypts based on RNAseq as in Fig. . c , Gene ontology analysis of the differentially expressed genes (DEGs) between the crypts with high (the top 10%) and low (the bottom 10%) DNAm as in Fig. . p-value was calculated by one-sided Fisher’s Exact test. d , Transferrin receptor ( Tfrc ) and ferroportin ( Slc40a1 ) expression levels in the Lgr5 hi cells isolated from young and old mice. n = 3 mice per group were analyzed. p-value is calculated by DESEQ2. e , Quantification of the western blot analysis as in Fig. . n = 5 mice per group were analyzed. p-value was calculated by Welch’s t-test, 2-tails. f , ChIP-qRT-PCR analysis of the ChIP of TET1, TET2 and TET3 on the Dkk2 gene promoter in the intestinal crypts isolated from young and old mice. n = 3 mice per group were analyzed. IgG was used as a control. p-value was calculated by Welch’s t-test, 2-tails. g , ChIP-qRT-PCR analysis of the ChIP of TET1, TET2 and TET3 on the Sfrp1 gene promoter in the intestinal crypts isolated from young and old mice. n = 3 mice per group were analyzed. IgG was used as a control. p-value was calculated by Welch’s t-test, 2-tails. Error bars in the figure bar charts represent the SD.

Journal: Nature Aging

Article Title: Iron homeostasis and cell clonality drive cancer-associated intestinal DNA methylation drift in aging

doi: 10.1038/s43587-025-01021-x

Figure Lengend Snippet: a , The expression level of the Dnmt enzymes in high (red dots; n = 16) and low (blue dots; n = 12) 5mC crypts based on RNAseq as in Fig. . b , The expression level of the Tet enzymes in high (red dots; n = 16) and low (blue dots; n = 12) 5mC crypts based on RNAseq as in Fig. . c , Gene ontology analysis of the differentially expressed genes (DEGs) between the crypts with high (the top 10%) and low (the bottom 10%) DNAm as in Fig. . p-value was calculated by one-sided Fisher’s Exact test. d , Transferrin receptor ( Tfrc ) and ferroportin ( Slc40a1 ) expression levels in the Lgr5 hi cells isolated from young and old mice. n = 3 mice per group were analyzed. p-value is calculated by DESEQ2. e , Quantification of the western blot analysis as in Fig. . n = 5 mice per group were analyzed. p-value was calculated by Welch’s t-test, 2-tails. f , ChIP-qRT-PCR analysis of the ChIP of TET1, TET2 and TET3 on the Dkk2 gene promoter in the intestinal crypts isolated from young and old mice. n = 3 mice per group were analyzed. IgG was used as a control. p-value was calculated by Welch’s t-test, 2-tails. g , ChIP-qRT-PCR analysis of the ChIP of TET1, TET2 and TET3 on the Sfrp1 gene promoter in the intestinal crypts isolated from young and old mice. n = 3 mice per group were analyzed. IgG was used as a control. p-value was calculated by Welch’s t-test, 2-tails. Error bars in the figure bar charts represent the SD.

Article Snippet: The complementary DNA of murine transferrin receptor ( Tfrc ) was purchased from Origene (plasmid MC221416 ) and cloned into the CSII-EF Venus-P2A-3F-MCS vector using the BamHI and NotI restriction sites.

Techniques: Expressing, Isolation, Western Blot, Quantitative RT-PCR, Control

a , Western blot analysis of the protein levels of the transferrin receptor (TfR1) in intestinal organoids derived from aged mice and analyzed 40 days after transduction with a 3xFlag-Tfrc- expressing lentivirus. Mock (parental vector) was used as a negative control. Actin was used as a loading control. n = 3 mice per group were analyzed. b , Quantification of TET hydroxymethylase enzymatic activity in intestinal organoids as in a . n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. c , Bar chart showing the DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing in intestinal organoids as in a . Parental organoids, untransduced organoids at day 0. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. d , Representative images of the western blot analysis of the protein levels of TfR1 and FPN1 in intestinal organoids cultured in different media as indicated. ENRW (EGF, Noggin, R-spondin1, Wnt3a); ENRC (EGF, Noggin, R-spondin1, CHIR99021). GAPDH was used as a loading control. n = 3 mice per group were analyzed. For details, see the main text. e , Ferrous (Fe 2+) iron levels in intestinal organoids as in d . n = 3 mice per group were analyzed. P value was calculated by one-way analysis of variance (ANOVA). f , Quantification of TET hydroxymethylase enzymatic activity in intestinal organoids as in d . n = 3 mice per group were analyzed. P value was calculated by one-way ANOVA. g , Representative images of the western blot analysis of the protein levels of the TfR1 and FPN1 in intestinal organoids treated with IFNγ (0.2 ng ml −1 ) or with both IFNγ (0.2 ng ml −1 ) and Wnt3a (100 ng ml −1 ) for 5 days as indicated. GAPDH was used as a loading control. n = 3 mice per group were analyzed. For details, see the main text. h , Ferrous (Fe 2+ ) iron levels in intestinal organoids as in g . n = 3 mice per group were analyzed. P value was calculated by one-way ANOVA. i , Quantification of TET hydroxymethylase enzymatic activity in intestinal organoids as in g . n = 3 mice per group were analyzed. P value was calculated by ordinary one-way ANOVA. Error bars in bar charts represent the s.d.

Journal: Nature Aging

Article Title: Iron homeostasis and cell clonality drive cancer-associated intestinal DNA methylation drift in aging

doi: 10.1038/s43587-025-01021-x

Figure Lengend Snippet: a , Western blot analysis of the protein levels of the transferrin receptor (TfR1) in intestinal organoids derived from aged mice and analyzed 40 days after transduction with a 3xFlag-Tfrc- expressing lentivirus. Mock (parental vector) was used as a negative control. Actin was used as a loading control. n = 3 mice per group were analyzed. b , Quantification of TET hydroxymethylase enzymatic activity in intestinal organoids as in a . n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. c , Bar chart showing the DNAm level of the Dkk2 gene promoter analyzed by BS pyrosequencing in intestinal organoids as in a . Parental organoids, untransduced organoids at day 0. n = 3 mice per group were analyzed. P value was calculated by a two-tailed Welch’s t -test. d , Representative images of the western blot analysis of the protein levels of TfR1 and FPN1 in intestinal organoids cultured in different media as indicated. ENRW (EGF, Noggin, R-spondin1, Wnt3a); ENRC (EGF, Noggin, R-spondin1, CHIR99021). GAPDH was used as a loading control. n = 3 mice per group were analyzed. For details, see the main text. e , Ferrous (Fe 2+) iron levels in intestinal organoids as in d . n = 3 mice per group were analyzed. P value was calculated by one-way analysis of variance (ANOVA). f , Quantification of TET hydroxymethylase enzymatic activity in intestinal organoids as in d . n = 3 mice per group were analyzed. P value was calculated by one-way ANOVA. g , Representative images of the western blot analysis of the protein levels of the TfR1 and FPN1 in intestinal organoids treated with IFNγ (0.2 ng ml −1 ) or with both IFNγ (0.2 ng ml −1 ) and Wnt3a (100 ng ml −1 ) for 5 days as indicated. GAPDH was used as a loading control. n = 3 mice per group were analyzed. For details, see the main text. h , Ferrous (Fe 2+ ) iron levels in intestinal organoids as in g . n = 3 mice per group were analyzed. P value was calculated by one-way ANOVA. i , Quantification of TET hydroxymethylase enzymatic activity in intestinal organoids as in g . n = 3 mice per group were analyzed. P value was calculated by ordinary one-way ANOVA. Error bars in bar charts represent the s.d.

Article Snippet: The complementary DNA of murine transferrin receptor ( Tfrc ) was purchased from Origene (plasmid MC221416 ) and cloned into the CSII-EF Venus-P2A-3F-MCS vector using the BamHI and NotI restriction sites.

Techniques: Western Blot, Derivative Assay, Transduction, Expressing, Plasmid Preparation, Negative Control, Control, Activity Assay, Two Tailed Test, Cell Culture

Protein sequencing results.

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: Protein sequencing results.

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Sequencing

A . Huh7 cells were transiently transfected with DDK tagged TFR1 cDNA. Lysate of transfected or non-transfected cells was immunoprecipitated with DDK or AF20 mAb, followed by sequential detection of the blot with DDK and TFR1 antibodies. B . Lysate of nontransfected Huh7 cells was incubated with AF20 mAb immobilized on protein G beads, or protein G beads alone to serve as a negative control, followed by Western blot detection of beads-associated proteins by antibodies against AF20, TFR1, HSP and N + /K + ATPase, respectively. Note that a minigel was used for electrophoresis, which could not resolve proteins of similar sizes.

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: A . Huh7 cells were transiently transfected with DDK tagged TFR1 cDNA. Lysate of transfected or non-transfected cells was immunoprecipitated with DDK or AF20 mAb, followed by sequential detection of the blot with DDK and TFR1 antibodies. B . Lysate of nontransfected Huh7 cells was incubated with AF20 mAb immobilized on protein G beads, or protein G beads alone to serve as a negative control, followed by Western blot detection of beads-associated proteins by antibodies against AF20, TFR1, HSP and N + /K + ATPase, respectively. Note that a minigel was used for electrophoresis, which could not resolve proteins of similar sizes.

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Transfection, Immunoprecipitation, Incubation, Negative Control, Western Blot, Electrophoresis

NIH 3T3 cells grown in 24-well plate with cover slips were transfected with expression constructs of DDK tagged TFR1, DDK tagged Na + /K + ATPase, or untagged HSP90. Cells were fixed with acid alcohol followed by staining with AF20, TFR1, DDK, and HSP90 antibodies, respectively. Note that AF20 mAb only revealed signals in TFR1 transfected cells, although all three proteins were successfully expressed in NIH 3T3 cells. In addition, cell death or unusual morphology (elongated) was observed in cells expressing the exogenous proteins (dead cells are indicated by arrows). All images were taken at 20x magnification.

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: NIH 3T3 cells grown in 24-well plate with cover slips were transfected with expression constructs of DDK tagged TFR1, DDK tagged Na + /K + ATPase, or untagged HSP90. Cells were fixed with acid alcohol followed by staining with AF20, TFR1, DDK, and HSP90 antibodies, respectively. Note that AF20 mAb only revealed signals in TFR1 transfected cells, although all three proteins were successfully expressed in NIH 3T3 cells. In addition, cell death or unusual morphology (elongated) was observed in cells expressing the exogenous proteins (dead cells are indicated by arrows). All images were taken at 20x magnification.

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Transfection, Expressing, Construct, Staining

TFR1 transfected NIH 3T3 cells were fixed and stained with either AF20 mAb (panel A) or TFR1 mAb (panel B), followed by confocal microscopy to reveal subcellular localization and 3D pattern of the protein. (C) Stacks of X axis for panels A and B, respectively.

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: TFR1 transfected NIH 3T3 cells were fixed and stained with either AF20 mAb (panel A) or TFR1 mAb (panel B), followed by confocal microscopy to reveal subcellular localization and 3D pattern of the protein. (C) Stacks of X axis for panels A and B, respectively.

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Transfection, Staining, Confocal Microscopy

Huh7 cell lysate was subject to immunoprecipitation with AF20 mAb and retained proteins on protein G beads were treated with PNGase F at 37°C for 1hr. Samples were directly loaded onto 10% SDS-PAGE (minigel) in duplicate followed by Western blot detection using AF20 (left) and TFR1 antibodies (right), respectively. Note that an additional protein band above the 75-kd size marker was detected by TFR1 antibody from PNGase F treated sample, most likely corresponding to deglycosylated form of TFR1 (79kDd).

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: Huh7 cell lysate was subject to immunoprecipitation with AF20 mAb and retained proteins on protein G beads were treated with PNGase F at 37°C for 1hr. Samples were directly loaded onto 10% SDS-PAGE (minigel) in duplicate followed by Western blot detection using AF20 (left) and TFR1 antibodies (right), respectively. Note that an additional protein band above the 75-kd size marker was detected by TFR1 antibody from PNGase F treated sample, most likely corresponding to deglycosylated form of TFR1 (79kDd).

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Immunoprecipitation, SDS Page, Western Blot, Marker

Three pairs of adjacent tissue sections of normal colon ( A ) and colon cancer ( B ) were stained with TFR1 (upper panels, 1:50 dilution) and AF20 mAb (lower panels, 1:500 dilution), respectively. Images were taken at 1000x magnification. Note that overexpression of both TFR1 and AF20 antigen was only observed in colon cancer but not in normal colon. In addition, the expression pattern and localization as revealed by TFR1 and AF20 Ab are indistinguishable.

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: Three pairs of adjacent tissue sections of normal colon ( A ) and colon cancer ( B ) were stained with TFR1 (upper panels, 1:50 dilution) and AF20 mAb (lower panels, 1:500 dilution), respectively. Images were taken at 1000x magnification. Note that overexpression of both TFR1 and AF20 antigen was only observed in colon cancer but not in normal colon. In addition, the expression pattern and localization as revealed by TFR1 and AF20 Ab are indistinguishable.

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Staining, Over Expression, Expressing

(A) Schematic representation of potential protein-binding domains of LZTFL1. (B) Purified LZTFL1 fused with maltose-binding protein (MBP, left ) as well as individual subunits of AP-1 complex (β1, γ, μ1, and σ1) fused with glutathione S-transferase (GST, right ) were visualized by Coomassie Brilliant Blue (CBB) staining. Full-length GST-β1 and GST-γ are indicated with red asterisks. (C) Purified MBP or MBP-LZTFL1 was incubated with each of the purified GST-fused subunits of the AP-1 complex (β1, γ, μ1, and σ1), and the LZTFL1-bound subunit was purified by amylose resin and analyzed by western blotting using anti-MBP and anti-GST antibodies. The GST-β1 band is indicated with a red asterisk. (D, top) Purified wild-type LZTFL1 and LZTFL1 mutants fused with MBP and (D, bottom) β1 and β2 subunits of AP-1 and AP-2 respectively fused with GST were visualized by CBB staining. Purified MBP, MBP-LZTFL1, or mutants were incubated with (E) GST-β1 (AP-1) or (F) GST-β2 (AP-2) and pulled-down proteins were analyzed by western blotting using anti-MBP and anti-GST antibodies. (G) Brain tissue lysate from wild-type and Lztfl1 -knockout mice was analyzed by western blotting using anti-LZTFL1 antibody, anti-γ subunit of AP-1 antibody, anti-α subunit of AP-2 antibody, and REVERT staining for total protein (left) . Lysate was immunoprecipitated with anti-LZTFL1-conjugated beads. The LZTFL1-interacting proteins were eluted by NuPAGE LDS buffer and analyzed by western blotting using anti-LZTFL1, anti-γ subunit of AP-1, and anti-α subunit of AP-2 antibodies (right) . (H, left) Lysate from HEK293FT cells transiently expressing FLAG or LZTFL1-FLAG was analyzed by western blotting using anti-FLAG, anti-β1 subunit and anti-γ subunit of AP-1, and anti-β-actin antibodies or (I, left) anti-FLAG, anti-α subunit of AP-2, and anti-actin antibodies. (H, right) Cell lysate was immunoprecipitated with anti-FLAG M2 magnetic beads. The LZTFL1-interacting proteins were eluted by 3X FLAG peptide and analyzed by western blotting using anti-FLAG, anti-β1 subunit of AP-1, and anti-γ subunit of AP-1 antibodies or (I, right) anti-FLAG and anti-α subunit of AP-2 antibodies.

Journal: PLoS ONE

Article Title: Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1

doi: 10.1371/journal.pone.0226298

Figure Lengend Snippet: (A) Schematic representation of potential protein-binding domains of LZTFL1. (B) Purified LZTFL1 fused with maltose-binding protein (MBP, left ) as well as individual subunits of AP-1 complex (β1, γ, μ1, and σ1) fused with glutathione S-transferase (GST, right ) were visualized by Coomassie Brilliant Blue (CBB) staining. Full-length GST-β1 and GST-γ are indicated with red asterisks. (C) Purified MBP or MBP-LZTFL1 was incubated with each of the purified GST-fused subunits of the AP-1 complex (β1, γ, μ1, and σ1), and the LZTFL1-bound subunit was purified by amylose resin and analyzed by western blotting using anti-MBP and anti-GST antibodies. The GST-β1 band is indicated with a red asterisk. (D, top) Purified wild-type LZTFL1 and LZTFL1 mutants fused with MBP and (D, bottom) β1 and β2 subunits of AP-1 and AP-2 respectively fused with GST were visualized by CBB staining. Purified MBP, MBP-LZTFL1, or mutants were incubated with (E) GST-β1 (AP-1) or (F) GST-β2 (AP-2) and pulled-down proteins were analyzed by western blotting using anti-MBP and anti-GST antibodies. (G) Brain tissue lysate from wild-type and Lztfl1 -knockout mice was analyzed by western blotting using anti-LZTFL1 antibody, anti-γ subunit of AP-1 antibody, anti-α subunit of AP-2 antibody, and REVERT staining for total protein (left) . Lysate was immunoprecipitated with anti-LZTFL1-conjugated beads. The LZTFL1-interacting proteins were eluted by NuPAGE LDS buffer and analyzed by western blotting using anti-LZTFL1, anti-γ subunit of AP-1, and anti-α subunit of AP-2 antibodies (right) . (H, left) Lysate from HEK293FT cells transiently expressing FLAG or LZTFL1-FLAG was analyzed by western blotting using anti-FLAG, anti-β1 subunit and anti-γ subunit of AP-1, and anti-β-actin antibodies or (I, left) anti-FLAG, anti-α subunit of AP-2, and anti-actin antibodies. (H, right) Cell lysate was immunoprecipitated with anti-FLAG M2 magnetic beads. The LZTFL1-interacting proteins were eluted by 3X FLAG peptide and analyzed by western blotting using anti-FLAG, anti-β1 subunit of AP-1, and anti-γ subunit of AP-1 antibodies or (I, right) anti-FLAG and anti-α subunit of AP-2 antibodies.

Article Snippet: Plasmids expressing human LZTFL1 (NM_020347) and TfR1 (NM_003234) with Myc-FLAG tag in pCMV6-Entry vector were purchased from OriGene Technologies (Rockville, MD).

Techniques: Protein Binding, Purification, Binding Assay, Staining, Incubation, Western Blot, Knock-Out, Immunoprecipitation, Expressing, Magnetic Beads

(A) Schematic representation of wild-type and LZTFL1 mutants. (B) Cell lysate from HEK293FT cells expressing FLAG-tagged wild-type LZTFL1 or the indicated mutants was analyzed by western blotting using anti-FLAG, anti-γ subunit of AP-1, anti-β1 subunit of AP-1, and anti-β-actin antibodies. Cell lysate was immunoprecipitated with anti-FLAG M2 magnetic beads. The interacting proteins were eluted by 3X FLAG peptide and analyzed by western blotting using anti-FLAG, anti-γ subunit of AP-1, and anti-β1 subunit of AP-1 antibodies. (C) Lysate from HEK293FT cells transiently expressing GFP-FLAG, LZTFL1-FLAG, or the indicated mutants was analyzed by western blotting using anti-FLAG, anti-α subunit of AP-2, and anti-tubulin antibodies. Lysate was immunoprecipitated and analyzed by western blotting using anti-FLAG and anti-α subunit of AP-2 antibodies.

Journal: PLoS ONE

Article Title: Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1

doi: 10.1371/journal.pone.0226298

Figure Lengend Snippet: (A) Schematic representation of wild-type and LZTFL1 mutants. (B) Cell lysate from HEK293FT cells expressing FLAG-tagged wild-type LZTFL1 or the indicated mutants was analyzed by western blotting using anti-FLAG, anti-γ subunit of AP-1, anti-β1 subunit of AP-1, and anti-β-actin antibodies. Cell lysate was immunoprecipitated with anti-FLAG M2 magnetic beads. The interacting proteins were eluted by 3X FLAG peptide and analyzed by western blotting using anti-FLAG, anti-γ subunit of AP-1, and anti-β1 subunit of AP-1 antibodies. (C) Lysate from HEK293FT cells transiently expressing GFP-FLAG, LZTFL1-FLAG, or the indicated mutants was analyzed by western blotting using anti-FLAG, anti-α subunit of AP-2, and anti-tubulin antibodies. Lysate was immunoprecipitated and analyzed by western blotting using anti-FLAG and anti-α subunit of AP-2 antibodies.

Article Snippet: Plasmids expressing human LZTFL1 (NM_020347) and TfR1 (NM_003234) with Myc-FLAG tag in pCMV6-Entry vector were purchased from OriGene Technologies (Rockville, MD).

Techniques: Expressing, Western Blot, Immunoprecipitation, Magnetic Beads

(A) HeLa cells were incubated with or without 7.5 μg/ml BFA for 2 minutes, washed with complete DMEM to remove BFA, and incubated with complete DMEM for 0, 15, 30, and 60 minutes. Cells were fixed and stained with antibodies to LZTFL1 (green), γ subunit of AP-1 (red) and p230 (TGN marker, magenta). Scale bar = 10 μm. (B) Quantitative analysis of the colocalization of LZTFL1 and AP-1 at the TGN (mean + SD). Student’s t-test, n>30 cells, ***p<0.001.

Journal: PLoS ONE

Article Title: Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1

doi: 10.1371/journal.pone.0226298

Figure Lengend Snippet: (A) HeLa cells were incubated with or without 7.5 μg/ml BFA for 2 minutes, washed with complete DMEM to remove BFA, and incubated with complete DMEM for 0, 15, 30, and 60 minutes. Cells were fixed and stained with antibodies to LZTFL1 (green), γ subunit of AP-1 (red) and p230 (TGN marker, magenta). Scale bar = 10 μm. (B) Quantitative analysis of the colocalization of LZTFL1 and AP-1 at the TGN (mean + SD). Student’s t-test, n>30 cells, ***p<0.001.

Article Snippet: Plasmids expressing human LZTFL1 (NM_020347) and TfR1 (NM_003234) with Myc-FLAG tag in pCMV6-Entry vector were purchased from OriGene Technologies (Rockville, MD).

Techniques: Incubation, Staining, Marker

(A) Cell lysate from control siRNA and AP-1 siRNA treated HeLa cells was analyzed by western blotting using anti-γ subunit of AP-1, anti-LZTFL1 and REVERT staining for total protein ( left ). Quantitation of AP-1 level in control siRNA and AP-1 siRNA treated HeLa cells (mean ± SD) is shown. Student’s t-test, n = 3, ***p<0.001 ( right ). (B) Immunofluorescence microscopy of control siRNA and AP-1 siRNA treated HeLa cells fixed and stained with antibodies to γ subunit of AP-1 (green), LZTFL1 (red), p230 (TGN marker, magenta), and DAPI (blue) (top) . Scale bar = 10 μm. Quantitative analysis of relative LZTFL1 intensity at the TGN of control siRNA or AP-1 siRNA treated HeLa cells (mean ± SD) is shown (bottom) . Student’s t-test, n>120 cells, ***p<0.0001.

Journal: PLoS ONE

Article Title: Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1

doi: 10.1371/journal.pone.0226298

Figure Lengend Snippet: (A) Cell lysate from control siRNA and AP-1 siRNA treated HeLa cells was analyzed by western blotting using anti-γ subunit of AP-1, anti-LZTFL1 and REVERT staining for total protein ( left ). Quantitation of AP-1 level in control siRNA and AP-1 siRNA treated HeLa cells (mean ± SD) is shown. Student’s t-test, n = 3, ***p<0.001 ( right ). (B) Immunofluorescence microscopy of control siRNA and AP-1 siRNA treated HeLa cells fixed and stained with antibodies to γ subunit of AP-1 (green), LZTFL1 (red), p230 (TGN marker, magenta), and DAPI (blue) (top) . Scale bar = 10 μm. Quantitative analysis of relative LZTFL1 intensity at the TGN of control siRNA or AP-1 siRNA treated HeLa cells (mean ± SD) is shown (bottom) . Student’s t-test, n>120 cells, ***p<0.0001.

Article Snippet: Plasmids expressing human LZTFL1 (NM_020347) and TfR1 (NM_003234) with Myc-FLAG tag in pCMV6-Entry vector were purchased from OriGene Technologies (Rockville, MD).

Techniques: Control, Western Blot, Staining, Quantitation Assay, Immunofluorescence, Microscopy, Marker

Immunofluorescence microscopy of HeLa cells fixed and stained with antibodies to (A) AP-1 (green), TfR1 (red) and DAPI (blue), scale bar = 10 μm. (B) LZTFL1 (green), TfR1 (red) and DAPI (blue), scale bar = 10 μm. (C) Pearson’s correlation coefficient of the colocalization of AP-1 or LZTFL1 with TfR1 at the TGN (mean ± SD). n>20 cells from three independent experiments. Costes significance test, p = 1. (D) Lysate from HEK293FT cells was immunoprecipitated with mouse IgG and either anti-γ subunit of AP-1 (left) or anti-α subunit of AP-2 (right) conjugated beads. The interacting proteins were eluted by NuPAGE LDS buffer and analyzed by western blotting using anti- γ subunit of AP-1, anti-α subunit of AP-2, anti-TfR1 and REVERT staining for total protein. (E) Lysate from wild-type and LZTFL1 -knockout HeLa cells was immunoprecipitated with anti-LZTFL1-conjugated beads. The LZTFL1-interacting proteins were eluted by NuPAGE LDS buffer and analyzed by western blotting using anti-LZTFL1, anti-TfR1 and REVERT staining for total protein. (F) Factor Xa cleaved MBP-LZTFL1 was incubated with TfR1-Myc-Flag and immunoprecipitated with anti-TfR1 conjugated protein A/G magnetic beads (left) or incubated with purified GST-fused β1 subunits of the AP-1 complex and pulled down with Glutathione Sepharose 4B (right) . The pulled down proteins were analyzed by western blotting using anti-LZTFL1, anti-MBP, anti-TfR1 and anti-GST antibodies. (G) Lysate from HEK293FT cells transiently expressing GFP-FLAG, LZTFL1-FLAG, or the indicated mutants was immunoprecipitated and analyzed by western blotting using anti-FLAG and anti-TfR1 antibodies (left) . Lysate was analyzed by western blotting using anti-FLAG, anti-TfR1, and anti-tubulin antibodies (right) .

Journal: PLoS ONE

Article Title: Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1

doi: 10.1371/journal.pone.0226298

Figure Lengend Snippet: Immunofluorescence microscopy of HeLa cells fixed and stained with antibodies to (A) AP-1 (green), TfR1 (red) and DAPI (blue), scale bar = 10 μm. (B) LZTFL1 (green), TfR1 (red) and DAPI (blue), scale bar = 10 μm. (C) Pearson’s correlation coefficient of the colocalization of AP-1 or LZTFL1 with TfR1 at the TGN (mean ± SD). n>20 cells from three independent experiments. Costes significance test, p = 1. (D) Lysate from HEK293FT cells was immunoprecipitated with mouse IgG and either anti-γ subunit of AP-1 (left) or anti-α subunit of AP-2 (right) conjugated beads. The interacting proteins were eluted by NuPAGE LDS buffer and analyzed by western blotting using anti- γ subunit of AP-1, anti-α subunit of AP-2, anti-TfR1 and REVERT staining for total protein. (E) Lysate from wild-type and LZTFL1 -knockout HeLa cells was immunoprecipitated with anti-LZTFL1-conjugated beads. The LZTFL1-interacting proteins were eluted by NuPAGE LDS buffer and analyzed by western blotting using anti-LZTFL1, anti-TfR1 and REVERT staining for total protein. (F) Factor Xa cleaved MBP-LZTFL1 was incubated with TfR1-Myc-Flag and immunoprecipitated with anti-TfR1 conjugated protein A/G magnetic beads (left) or incubated with purified GST-fused β1 subunits of the AP-1 complex and pulled down with Glutathione Sepharose 4B (right) . The pulled down proteins were analyzed by western blotting using anti-LZTFL1, anti-MBP, anti-TfR1 and anti-GST antibodies. (G) Lysate from HEK293FT cells transiently expressing GFP-FLAG, LZTFL1-FLAG, or the indicated mutants was immunoprecipitated and analyzed by western blotting using anti-FLAG and anti-TfR1 antibodies (left) . Lysate was analyzed by western blotting using anti-FLAG, anti-TfR1, and anti-tubulin antibodies (right) .

Article Snippet: Plasmids expressing human LZTFL1 (NM_020347) and TfR1 (NM_003234) with Myc-FLAG tag in pCMV6-Entry vector were purchased from OriGene Technologies (Rockville, MD).

Techniques: Immunofluorescence, Microscopy, Staining, Immunoprecipitation, Western Blot, Knock-Out, Incubation, Magnetic Beads, Purification, Expressing

(A) Wild-type and LZTFL1 -knockout HeLa cells were labeled with 2 mM Sulfo-NHS-LC-Biotin. Biotin-labeled proteins were extracted as described in the Methods and were analyzed by western blotting using anti-TfR1, anti-LZTFL1, and REVERT staining for total protein. (B) Quantitation of cell surface TfR1 level in wild-type and LZTFL1 -knockout HeLa cells (mean ± SD). Student’s t-test, n = 3, ***p<0.0001. (C) Biotin-labeled proteins were extracted from wild-type and LZTFL1 -knockout HeLa cells as described in the Methods and were analyzed by western blotting using anti-EGFR, anti-CI-MPR, anti-LZTFL1, and REVERT staining for total protein. (D) Quantitation of cell surface EGFR and CI-MPR levels in wild-type and LZTFL1-knockout HeLa cells (mean + SD). Student’s t-test, n = 4, n.s., not significant. (E) Wild-type and LZTFL1 -knockout HeLa cells were labeled with 2 mM Sulfo-NHS-SS-Biotin at 4°C. Biotin-labeled cells were incubated with complete DMEM for 0, 10, and 20 minutes to allow protein internalization. The remaining biotin-labeled cell surface proteins were removed with cold 100 mM Mesna followed by quenching with 120 mM iodoacetamide. Biotin-labeled proteins were then extracted as described in the Methods and were analyzed by western blotting using anti-TfR1 antibody, anti-LZTFL1 antibody, and REVERT staining for total protein. (F) Quantitation of internalized TfR1 level in wild-type and LZTFL1 -knockout HeLa cells (mean ± SD). Student’s t-test, n = 4, **p<0.005.

Journal: PLoS ONE

Article Title: Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1

doi: 10.1371/journal.pone.0226298

Figure Lengend Snippet: (A) Wild-type and LZTFL1 -knockout HeLa cells were labeled with 2 mM Sulfo-NHS-LC-Biotin. Biotin-labeled proteins were extracted as described in the Methods and were analyzed by western blotting using anti-TfR1, anti-LZTFL1, and REVERT staining for total protein. (B) Quantitation of cell surface TfR1 level in wild-type and LZTFL1 -knockout HeLa cells (mean ± SD). Student’s t-test, n = 3, ***p<0.0001. (C) Biotin-labeled proteins were extracted from wild-type and LZTFL1 -knockout HeLa cells as described in the Methods and were analyzed by western blotting using anti-EGFR, anti-CI-MPR, anti-LZTFL1, and REVERT staining for total protein. (D) Quantitation of cell surface EGFR and CI-MPR levels in wild-type and LZTFL1-knockout HeLa cells (mean + SD). Student’s t-test, n = 4, n.s., not significant. (E) Wild-type and LZTFL1 -knockout HeLa cells were labeled with 2 mM Sulfo-NHS-SS-Biotin at 4°C. Biotin-labeled cells were incubated with complete DMEM for 0, 10, and 20 minutes to allow protein internalization. The remaining biotin-labeled cell surface proteins were removed with cold 100 mM Mesna followed by quenching with 120 mM iodoacetamide. Biotin-labeled proteins were then extracted as described in the Methods and were analyzed by western blotting using anti-TfR1 antibody, anti-LZTFL1 antibody, and REVERT staining for total protein. (F) Quantitation of internalized TfR1 level in wild-type and LZTFL1 -knockout HeLa cells (mean ± SD). Student’s t-test, n = 4, **p<0.005.

Article Snippet: Plasmids expressing human LZTFL1 (NM_020347) and TfR1 (NM_003234) with Myc-FLAG tag in pCMV6-Entry vector were purchased from OriGene Technologies (Rockville, MD).

Techniques: Knock-Out, Labeling, Western Blot, Staining, Quantitation Assay, Incubation

(A) Wild-type and LZTFL1 -knockout HeLa cells were loaded with 25 μg/ml of Tfn-568 on ice for 30 minutes, washed, and incubated with complete DMEM for 0, 20, and 30 minutes at 37°C. Time course of Tfn-568 internalization was monitored by loss of fluorescence. Scale bar = 20 μm. (B) Quantitation of Tfn-568 internalization intensity as a percentage normalized with the intensity at time point 0 (100%) in wild-type and LZTFL1 -knockout HeLa cells (mean ± SD). Student’s t-test, n>100 cells, ***p<0.0001. (C) Wild-type and LZTFL1 -knockout HeLa cells were incubated with 25 μg/ml Tfn-568 for the indicated times, and the Tfn uptake level was measured by the accumulation of Tfn-568. Scale bar = 20 μm. (D) Quantitation of Tfn-568 accumulation in wild-type and LZTFL1 -knockout HeLa cells (mean ± SD). Student’s t-test, n>100 cells, ***p<0.0001. (E) Wild-type and LZTFL1 -knockout HeLa cells were loaded with 25 μg/ml Tfn-568 for 30 minutes, washed, and incubated with complete DMEM for the indicated times. Time course of Tfn-568 efflux was monitored by loss of fluorescence. Scale bar = 20 μm. (F) Quantitation of Tfn-568 efflux intensity as a percentage normalized with the intensity at time point 0 (100%) in wild-type and LZTFL1 -knockout HeLa cells (mean ± SD). Student’s t-test, n>100 cells, ***p<0.0001.

Journal: PLoS ONE

Article Title: Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1

doi: 10.1371/journal.pone.0226298

Figure Lengend Snippet: (A) Wild-type and LZTFL1 -knockout HeLa cells were loaded with 25 μg/ml of Tfn-568 on ice for 30 minutes, washed, and incubated with complete DMEM for 0, 20, and 30 minutes at 37°C. Time course of Tfn-568 internalization was monitored by loss of fluorescence. Scale bar = 20 μm. (B) Quantitation of Tfn-568 internalization intensity as a percentage normalized with the intensity at time point 0 (100%) in wild-type and LZTFL1 -knockout HeLa cells (mean ± SD). Student’s t-test, n>100 cells, ***p<0.0001. (C) Wild-type and LZTFL1 -knockout HeLa cells were incubated with 25 μg/ml Tfn-568 for the indicated times, and the Tfn uptake level was measured by the accumulation of Tfn-568. Scale bar = 20 μm. (D) Quantitation of Tfn-568 accumulation in wild-type and LZTFL1 -knockout HeLa cells (mean ± SD). Student’s t-test, n>100 cells, ***p<0.0001. (E) Wild-type and LZTFL1 -knockout HeLa cells were loaded with 25 μg/ml Tfn-568 for 30 minutes, washed, and incubated with complete DMEM for the indicated times. Time course of Tfn-568 efflux was monitored by loss of fluorescence. Scale bar = 20 μm. (F) Quantitation of Tfn-568 efflux intensity as a percentage normalized with the intensity at time point 0 (100%) in wild-type and LZTFL1 -knockout HeLa cells (mean ± SD). Student’s t-test, n>100 cells, ***p<0.0001.

Article Snippet: Plasmids expressing human LZTFL1 (NM_020347) and TfR1 (NM_003234) with Myc-FLAG tag in pCMV6-Entry vector were purchased from OriGene Technologies (Rockville, MD).

Techniques: Knock-Out, Incubation, Fluorescence, Quantitation Assay

Fig. 3. Distribution of certain glycoproteins on the cellular lipid raft during PRRSV entry and lipid raft-location of receptor CD163. (A) The distribution of Gp3, Gp4, Gp5, and CD163 in the different sucrose gradient fractions during entry. PAMs were incubated with Hpv at an MOI of 5 at 4 1C for 1 h and then switched to 37 1C for 2 h. Cells were extracted in Triton X-100 and fractionated by discontinuous sucrose gradient centrifugation as described in Materials and Methods. The fractions were separated by SDS-12% PAGE and transferred to PVDF membranes for immunoblot analysis for nonraft marker CD71, raft maker caveolin (Cav), Gp3, Gp4, Gp5, or CD163. (B) The distribution of Gp3, Gp4, Gp5, and CD163 in different sucrose gradient fractions during PRRSV entry upon MβCD pretreatment. PAMs were pretreated with 20 mM MβCD for 1 h and then incubated with Hpv at an MOI of 5 at 4 1C for 1 h and then switched to 37 1C for 2 h. Cells were extracted in Triton X-100 and fractionated by discontinuous sucrose gradient centrifugation as described in Materials and Methods. The fractions were separated by SDS-12% PAGE and transferred to PVDF membranes for immunoblot analysis for CD71, Cav, Gp3, Gp4, Gp5, or CD163. (C) MβCD treatment affected the distribution of CD163. Hela cells were transfected with plasmid encoding CD163 and treated with 20 mM MβCD at 37 1C for 1 h at 24 h post transfection. The cells treated with PBS were set as a control. The expression of CD163 on cell membrane was stained by indirect immunofluorescence assay after MβCD treatment. (D) Association of CD163 with lipid rafts. PAMs were extracted in Triton X-100 and fractionated on sucrose gradients. Proteins were resolved on SDS-PAGE and transferred to PVDF membrane for immunoblot analysis of CD163, Cav, and CD71.

Journal: Virology

Article Title: Lipid rafts both in cellular membrane and viral envelope are critical for PRRSV efficient infection.

doi: 10.1016/j.virol.2015.06.005

Figure Lengend Snippet: Fig. 3. Distribution of certain glycoproteins on the cellular lipid raft during PRRSV entry and lipid raft-location of receptor CD163. (A) The distribution of Gp3, Gp4, Gp5, and CD163 in the different sucrose gradient fractions during entry. PAMs were incubated with Hpv at an MOI of 5 at 4 1C for 1 h and then switched to 37 1C for 2 h. Cells were extracted in Triton X-100 and fractionated by discontinuous sucrose gradient centrifugation as described in Materials and Methods. The fractions were separated by SDS-12% PAGE and transferred to PVDF membranes for immunoblot analysis for nonraft marker CD71, raft maker caveolin (Cav), Gp3, Gp4, Gp5, or CD163. (B) The distribution of Gp3, Gp4, Gp5, and CD163 in different sucrose gradient fractions during PRRSV entry upon MβCD pretreatment. PAMs were pretreated with 20 mM MβCD for 1 h and then incubated with Hpv at an MOI of 5 at 4 1C for 1 h and then switched to 37 1C for 2 h. Cells were extracted in Triton X-100 and fractionated by discontinuous sucrose gradient centrifugation as described in Materials and Methods. The fractions were separated by SDS-12% PAGE and transferred to PVDF membranes for immunoblot analysis for CD71, Cav, Gp3, Gp4, Gp5, or CD163. (C) MβCD treatment affected the distribution of CD163. Hela cells were transfected with plasmid encoding CD163 and treated with 20 mM MβCD at 37 1C for 1 h at 24 h post transfection. The cells treated with PBS were set as a control. The expression of CD163 on cell membrane was stained by indirect immunofluorescence assay after MβCD treatment. (D) Association of CD163 with lipid rafts. PAMs were extracted in Triton X-100 and fractionated on sucrose gradients. Proteins were resolved on SDS-PAGE and transferred to PVDF membrane for immunoblot analysis of CD163, Cav, and CD71.

Article Snippet: Anti-CD71 antibody was purchased from Acris Antibodies GmbH.

Techniques: Incubation, Gradient Centrifugation, Western Blot, Marker, Transfection, Plasmid Preparation, Control, Expressing, Membrane, Staining, SDS Page

Fig. 4. Association of lipid raft with PRRSV replication. (A) The effect of PRRSV replication at the indicated time intervals in PAMs upon MβCD treatment. PAMs were infected with Hpv at an MOI of 1 for 12 h (represented as 0 h on graph), and then the medium was replaced with fresh medium containing 10 mM MβCD. ORF7 RNA level in cells was analyzed using real-time RT-PCR at 0, 6, and 12 h after treatment. Data shown as mean7standard deviation from three independent experiments. Significant differences compared with 0 h group are denoted by * (Po0.05) and ** (Po0.01). (B) Association of Nsp9 with raft. PAMs were harvested 24 h after infection with Hpv at an MOI of 1. Cells were extracted in Triton X-100 and fractionated by discontinuous sucrose gradient centrifugation as described in Materials and Methods. Each fraction was resolved on SDS-PAGE and transferred to PVDF membrane for immunoblot analysis of Nsp9, Cav, and CD71. (C) PAMs were harvested 24 h after infection with Hpv at an MOI of 1. Cells were treated with 20 mM MβCD for 1 h and then extracted in Triton X-100 and fractionated by discontinuous sucrose gradient centrifugation as described in Materials and Methods. Each fraction was resolved on SDS-PAGE and transferred to PVDF membrane for immunoblot analysis of Nsp9, Cav, and CD71.

Journal: Virology

Article Title: Lipid rafts both in cellular membrane and viral envelope are critical for PRRSV efficient infection.

doi: 10.1016/j.virol.2015.06.005

Figure Lengend Snippet: Fig. 4. Association of lipid raft with PRRSV replication. (A) The effect of PRRSV replication at the indicated time intervals in PAMs upon MβCD treatment. PAMs were infected with Hpv at an MOI of 1 for 12 h (represented as 0 h on graph), and then the medium was replaced with fresh medium containing 10 mM MβCD. ORF7 RNA level in cells was analyzed using real-time RT-PCR at 0, 6, and 12 h after treatment. Data shown as mean7standard deviation from three independent experiments. Significant differences compared with 0 h group are denoted by * (Po0.05) and ** (Po0.01). (B) Association of Nsp9 with raft. PAMs were harvested 24 h after infection with Hpv at an MOI of 1. Cells were extracted in Triton X-100 and fractionated by discontinuous sucrose gradient centrifugation as described in Materials and Methods. Each fraction was resolved on SDS-PAGE and transferred to PVDF membrane for immunoblot analysis of Nsp9, Cav, and CD71. (C) PAMs were harvested 24 h after infection with Hpv at an MOI of 1. Cells were treated with 20 mM MβCD for 1 h and then extracted in Triton X-100 and fractionated by discontinuous sucrose gradient centrifugation as described in Materials and Methods. Each fraction was resolved on SDS-PAGE and transferred to PVDF membrane for immunoblot analysis of Nsp9, Cav, and CD71.

Article Snippet: Anti-CD71 antibody was purchased from Acris Antibodies GmbH.

Techniques: Infection, Quantitative RT-PCR, Gradient Centrifugation, SDS Page, Membrane, Western Blot

HEV pORF1 predominantly localizes to CD63-positive vesicular structures. Analyses of subcellular distribution of pORF1 ectopically expressed in A549/D3 cells. ( A ) Confocal microscopy of double-tagged pORF1; EGFP-mCherry Merge displays the subcellular distribution of EGFP ( green )-mCherry ( red ) fusion protein without insertion of pORF1. C-term, C-terminal mCherry; N-term, N-terminal EGFP. ( B ) Particle analysis of only C-terminus–containing vesicles (C-term) and N- and C-terminus-containing vesicles (C+N-terminus). ∗∗∗ P > .0001; ∼300 particles were analyzed. ( C ) Confocal microscopy of C-terminally mScarlet-tagged pORF1 ( red ) and indirect immunofluorescent stain of different organelle marker proteins ( green ); ERGIC53, ERGIC; GM130, Golgi; EEA1, EEs; Rab11a, REs; LC3B, APs; LAMP2, LYs; CD63, MVBs. ( D ) Particle analysis of pORF1-containing vesicles (pORF1 alone) and pORF1- and marker protein–containing vesicles (pORF1 + marker); between ∼200 and ∼1000 particles were analyzed for each organelle marker. Single channels depicted as greyscale images with headers indicating the channel coloring; zoom refers to areas magnified from white rectangles in merge; white ellipses indicate nucleus; scale bar represents 40 μm. APs, autophagosomes; EEs, early endosomes; ERGIC, ER-Golgi intermediate compartment; Golgi, Golgi apparatus; LYs, lysosomes; MVBs, multivesicular bodies; REs, recycling endosomes. Data are displayed as mean ± standard error of the mean. Microscopy performed on Leica TCS SP8 System with 100× objective (numerical arperture 1.4). Images deconvoluted via lightning algorithm using LAS X Control software.

Journal: Cellular and Molecular Gastroenterology and Hepatology

Article Title: The Protease Domain in HEV pORF1 Mediates the Replicase’s Localization to Multivesicular Bodies and Its Exosomal Release

doi: 10.1016/j.jcmgh.2024.01.001

Figure Lengend Snippet: HEV pORF1 predominantly localizes to CD63-positive vesicular structures. Analyses of subcellular distribution of pORF1 ectopically expressed in A549/D3 cells. ( A ) Confocal microscopy of double-tagged pORF1; EGFP-mCherry Merge displays the subcellular distribution of EGFP ( green )-mCherry ( red ) fusion protein without insertion of pORF1. C-term, C-terminal mCherry; N-term, N-terminal EGFP. ( B ) Particle analysis of only C-terminus–containing vesicles (C-term) and N- and C-terminus-containing vesicles (C+N-terminus). ∗∗∗ P > .0001; ∼300 particles were analyzed. ( C ) Confocal microscopy of C-terminally mScarlet-tagged pORF1 ( red ) and indirect immunofluorescent stain of different organelle marker proteins ( green ); ERGIC53, ERGIC; GM130, Golgi; EEA1, EEs; Rab11a, REs; LC3B, APs; LAMP2, LYs; CD63, MVBs. ( D ) Particle analysis of pORF1-containing vesicles (pORF1 alone) and pORF1- and marker protein–containing vesicles (pORF1 + marker); between ∼200 and ∼1000 particles were analyzed for each organelle marker. Single channels depicted as greyscale images with headers indicating the channel coloring; zoom refers to areas magnified from white rectangles in merge; white ellipses indicate nucleus; scale bar represents 40 μm. APs, autophagosomes; EEs, early endosomes; ERGIC, ER-Golgi intermediate compartment; Golgi, Golgi apparatus; LYs, lysosomes; MVBs, multivesicular bodies; REs, recycling endosomes. Data are displayed as mean ± standard error of the mean. Microscopy performed on Leica TCS SP8 System with 100× objective (numerical arperture 1.4). Images deconvoluted via lightning algorithm using LAS X Control software.

Article Snippet: Primary antibodies were raised against ERGIC53/LMAN1 (lectin mannose-binding 1; Santa Cruz Biotechnologies, sc-365158), GM130/GOLGA2 (golgin A2; Cell Signaling, 12480S), EEA1 (early endosome antigen 1; Abcam, ab206860), Rab11a (Ras-related protein Rab-11A; ProSci, 33-825), (MAP1)LC3B (microtubule-associated protein 1 light chain 3-beta; MBL International, PM036 MBL), LAMP2/CD107b (lysosomal associated membrane protein 2; BD Biosciences, 555803), and CD63 (cluster of differentiation 63; Abcam, ab59479).

Techniques: Confocal Microscopy, Particle Size Analysis, Staining, Marker, Microscopy, Control, Software

SIRT1/NRF2/GPX4 pathway is involved in hippocampal ferroptosis in aged mice. (A) WB images and quantification analysis of SIRT1, NRF2 and GPX4 in the hippocampus of aged mice. (B) WB images and quantification analysis of SLC7A11, TFR1, IRP2 and ferritin in the hippocampus of aged mice ( n = 3 per group). (C) qRT‐PCR expression of SIRT1, NRF2, GPX4, SLC7A11, TFR1, IRP2 and ferritin mRNA in the hippocampus of aged mice ( n = 3 per group). Values are presented as mean ± SEM. ** p < 0.01 compared with the C group; # p < 0.05 and ## p < 0.01 compared with the M group; + p < 0.05 and ++ p < 0.01 and compared with the EX group.

Journal: Journal of Cellular and Molecular Medicine

Article Title: Electroacupuncture Pretreatment Ameliorates Perioperative Neurocognitive Disorder in Aged Mice by Inhibiting Ferroptosis Through the SIRT1 / NRF2 / GPX4 Pathway

doi: 10.1111/jcmm.71021

Figure Lengend Snippet: SIRT1/NRF2/GPX4 pathway is involved in hippocampal ferroptosis in aged mice. (A) WB images and quantification analysis of SIRT1, NRF2 and GPX4 in the hippocampus of aged mice. (B) WB images and quantification analysis of SLC7A11, TFR1, IRP2 and ferritin in the hippocampus of aged mice ( n = 3 per group). (C) qRT‐PCR expression of SIRT1, NRF2, GPX4, SLC7A11, TFR1, IRP2 and ferritin mRNA in the hippocampus of aged mice ( n = 3 per group). Values are presented as mean ± SEM. ** p < 0.01 compared with the C group; # p < 0.05 and ## p < 0.01 compared with the M group; + p < 0.05 and ++ p < 0.01 and compared with the EX group.

Article Snippet: The membrane was then incubated overnight at 4°C with primary antibodies: SIRT1 (1:850; Lot‐19G10A10; BOSTER), NRF2 (1:1500; Cat#YT3189; Immunoway), iron regulatory protein 2 (IRP2) (1:3000; Cat#YN3307; Immunoway), transferrin receptor 1 (TFR1) (1:750; LotNo‐23BP65E1; BOSTER), GPX4 (1:1500; Cat#YN3047; Immunoway), ferritin (1:3000; Cat#YT1692; Immunoway) and SLC7A11 (1:2000; Cat#YT8130; Immunoway).

Techniques: Quantitative RT-PCR, Expressing